Free Essay

Abhi

In:

Submitted By gachi
Words 1636
Pages 7
Modulo Arithmetic
Problem:
If we line up the students in this class in 2 rows, there is one student left. If we line up them in 3 rows, there are two left. If we line up them in 5 rows, there are 3 left. How many number of students in this class?

Definition. Given a, b are integers and n is a positive integer, a[pic]b (mod n) , or a and b are congruent modulo n, if n|(a-b).

Example. 3 [pic]0 (mod 3), 4[pic] 1 (mod 3), 5 [pic]2 (mod 3), 6[pic] 0 (mod 3), -1[pic] 2 (mod 3),
-2[pic] 1 (mod 3), …
Now, we can collect all integers that are congruent in the same set, called the congruent class, as defined in the following:

Definition. The set of integers congruent to r (mod n) is called the congruence class of r (mod n), is the set
[r]={ r + kn | k[pic] Z}
The collection of [0], [1], .., [n-1] is denoted by Zn.

Definition. The Integers modulo n, or Zn , is defined as
Zn ={[0], [1], [2], …, [n-1]}

Theorem. The following are equivalent: i) a[pic]b (mod n) ii) [a]=[b] iii) There are exactly n congruence classes (mod n), i.e., [0], [1], [2], …, [n-1]

The modulo arithmetic + and * do not depend on the representation, as in the following:

Theorem. If a, b, c, and d are integers, a[pic]b (mod n) and c[pic]d (mod n) i) a +c[pic]b +d (mod n) ii) ac[pic]bd (mod n)

Definition. If [r] and [s] are congruence classes (mod n), then
[r]+[s]=[r+s]
[r][s]=[rs]

Example. In Z4 ={[0], [1], [2], [3]}
[1]+[1]=[2], [1]+[2]=[3], [1]+[3]=[4]=[0], [2]+[2]=[0], [2]+[3]=[1], [3]+[3]=[2]
[2][2]=[4]=[0], [2][3]=[6]=[2], [3][3]=[9]=[1]

Definition. A non-zero element [r] [pic]Zn is called a zero-divisor if there exists a non-zero element [s] [pic]Zn such that [r][s]=[0].

Definition. A non-zero element [r] [pic]Zn is called a unit if there exists a non-zero element [s] [pic]Zn such that [r][s]=[1]. [s] is called a multiplicative inverse of [r], or [r]-1.

Example. In Z4,
[2] is a zero-divisor and [3] is a unit. The multiplicative inverse of [3] is itself.

Example.
What is [15]-1 (mod 2)?
Solution:
Since 15*1 (mod 2)= 1 (mod 2), [15]-1 =[1].

Theorem. For a congruence class [r] [pic]Zn, the following are equivalent: i) gcd (m, n)=1 ii) [m] has a multiplicative inverse. iii) [m] is not a zero-divisor in Zn.

Example.
In Z4, n=4, m=3, gcd(3,4)=1. Hence [3] has a multiplicative inverse, which is itself.

Corollary.
Every non-zero [r] in Zn has a multiplicative inverse if and only if n is a prime,.

Example.
In Z5, n=5, [1]-1 = [1], [2]-1 = [3], [3]-1 = [2], [4]-1 = [4].

Definition. A function f has a period of r (positive integer) if f(x+r)=f(x), for every x.

Example.
In Z4, calculate the Fibonacci sequence.

[0], [1], [1], [2], [3], [1], [0], [1], …
The period is 6.

Theorem. (The Chinese Remainder Theorem)
Assume that a1, a2, …, am are integers, and n1, n2, …, nm are positive integers such that gcd (ni, nj)=1 if i [pic] j (ni, nj are called relatively prime).
Then the system equation X[pic] a1 (mod n1) X[pic] a2 (mod n2) … X[pic] am (mod nm)
Has a unique solution X modulo N=n1 *n2 *…*nm

Proof:
Let Ni = [pic][pic] = [pic]. Obviously, Ni [pic] 0 (mod nj), where i=1, 2, …, m and i[pic]j
Then gcd (Ni, ni)=1. Hence there is a multiplicative inverse Ri (=Ni-1) of Ni (mod ni).

Let X= [pic]. Since X= [pic][pic] ai (mod ni), X is the unique solution.

Example.
If we line up the students in this class in 2 rows, there is one student left. If we line up them in 3 rows, there are two left. If we line up them in 5 rows, there are 3 left. How many number of students in this class?
That is, to solve the system equation X[pic] 1 (mod 2) X[pic] 2 (mod 3) X[pic] 3 (mod 5)

Solution: m=3, a1=1, a2=2, a3=3, n1 =2, n2=3, n3=5. N= n1*n2* n3 =30
N1 = n2* n3 = 15, R1 =1 (mod 2)
N2 = n1* n3 = 10, R2 =1 (mod 3)
N3 = n1* n2 = 6, R3 =1 (mod 5)
X= [pic]=15*1*1+10*1*2+6*1*3=53 (mod 30)=23 (mod 30)
Ans: 23, 53, 83, 113, …
Applications.
A. DNA Model (Z4) The genetic code in DNA of organism is in the form of double helix, each consisting of a sequence of nucleotides: T(Thymine), A(Adenine), C(Cytosine) and G(Guanine). The double helix is governed by Chargaff’s Rules: T pairs with A and G pairs with C. If we set T=0, A=2, G=1 and C=3, then every helix can interchange to another strand of helix by using modulo arithmetic (adding 2) in Z4. For example, one strand of the human TSH- [pic]gene has the genetic code as GGTCACCACAGCATCTGCTCACCAATGCAAAGTAAG This can be represented in by Z4 as 1103233232132030130323322013222102221 After adding 2 (mod 4) respectively, the other helix code is 3321011010310212312101100231000320003 The genetic code is CCAGTGGTGTCGTAGACGAGTGGTTACGTTTCATTTC B. Public Key Encryption/Decryption (RSA Algorithm) The public key encryption is used by a sender to transmit a secret key. The sender first encrypts the key (called a plain text T, e.g., a positive integer from the key’s ASCII code) using a public key (displayed from a web site) and transmit it (called a cipher text C) to the other person. The receiver will use the corresponding private key to decode the message and know the secret key. Then the receiver will use the secret key to communicate with the sender. The idea is that even people know the public key, it is supposed very hard to find the corresponding private key to decode it. One such algorithm is called RSA algorithm (developed in 1976 by Rivest, Shamir and Adleman at MIT) is described as follows: (PQ, E) is the public key) 1) Choose 2 different prime numbers P and Q. (In practice, each has 200 digits). 2) Choose an odd number E such that gcd (E, (P-1)(Q-1)) = 1 3) By the theorem above, find a multiplicative inverse of E (mod (P-1)(Q-1)), called D (the private key). That is ED [pic]1 (mod (P-1)(Q-1)) Assume that ED=1+m(P-1)(Q-1), where m is an integer 4) The cipher text C is created by C=TE (mod PQ). 5) To decipher C, the receiver performs

CD (mod PQ)= TED (mod PQ)= (T Tm(P-1)(Q-1)) (mod PQ) If gcd(T,P)=1, then by Fermat theorem, Tm(P-1) [pic] 1 (mod P), or Tm(P-1)(Q-1) [pic] 1 (mod P) If gcd(T,Q)=1, then by Fermat theorem, Tm(Q-1) [pic] 1 (mod Q), or Tm(P-1)(Q-1) [pic] 1 (mod Q) Therefore, if gcd(T,P)=1 and gcd(T,Q)=1, then by Chinese Reminder Theorem that Tm(P-1)(Q-1) [pic] 1 (mod PQ), or CD (mod PQ)=T (mod PQ)

The receiver can recover the original plain text T.

Note: 1) Choose 2 large primes P and Q:

i) The Fermat’s Little Theorem (Fermat’s primes p) If p is prime and a is an integer not divisible by p, then ap-1 [pic]1 (mod p). Example. Let a=2, p=5. 24 = 16 [pic]1 (mod 5)

However, this does not guarantee that if an-1 [pic]1 (mod n), then n is a prime. This composite number n is called a Carmichael number (or a pseudo-prime) Example. Let a=2, n=561=3*11*17 Then 2560=(22) 280 [pic]1280 (mod 3) [pic]1 (mod 3) [pic]1 (mod 561). n=561 is not a prime.

ii) The Euclid’s primes Let Nn = p1 * p2 * …* pn +1, where p1, p2, …, pn are the first n primes in order). Then N1, N2, N3, N4, N5, N11, N75, N171, and N172 are primes. No other Nn are primes for 1 [pic]n[pic] 200.

iii) The Mersenne primes If p is a prime, then Mp =2p -1 is called a Mersenne number. Lucas Theorem. Mp is prime if and only if Mp divides S, where S0 = 4, S1 = 42 -2=14, S2 = 142 -2, …, Sk = Sk-12 -2.

iv) The Gaussian primes 2k If a prime has the form 2 +1, it is a Gaussian prime. Only when k=0, 1, 2, 3, 4, it is prime. 2) Choose an odd integer E that is not divisible by (P-1)(Q-1) 3) D can be found using the Euclidean algorithm and Extended Euclidean algorithm as follows: Procedure moduloMultiplicativeInverse (given a, b are positive integers and a [pic]b, modulo n) // stores all quotient in array q[0], q[1], … and stores as count the number of steps used in Euclidean //Algorithm // The following is the Euclidean Algorithm x=a y=b i=0 While y [pic] 0 q[i]=x div y r=x mod y x=y y=r i++

count=i

// the following is the extended Euclidean algorithm xprev=0 x=1 for i=0 to count-2 xnew=( xprev-x*q[i]) mod n xprev=x x=xnew // make x non-negative while x

Similar Documents

Free Essay

Abhi

...Dear Friend. I humbly request your consent and co-operation so as I can present you as an heir/next-of-kin of a deceased account proceeds value 5,508,609.00 INR (Five Crore five Lakh eight thousand Six Hundred and Nine India rupees only) I am writing this letter in confidence believing that it is the wish of God to meet with you since we have not met before, I got your e-mail address from AOL- Local Yellow Page with regard to your profile, after searching all the job site, Hindu, matrimony and religious site looking for a trust worthy person and I decided to contact you. I am Mrs. Kavita Mazumdar of Auditing and accounting section staff in Royal bank of Scotland Barakhamba road branch New Delhi, during my investigation and auditing I came across many inactive accounts but there is a particular account that has not been noticed by the previous/past auditors the account has been dormant without any claim of the fund. I write to solicit for your support and assistance to carry out this deal in my bank that will benefit us. Lying in one of the many inactive accounts is the sum of 5,508,609.00 INR (Five Crore fifty Lakhs eight thousand Six Hundred and Nine India rupees only) belonging to a foreign customer (Mr.Chowalert Jitjamnong) who was a gas consultant here in India, he happened to be deceased during a vacation trip with his wife (Mrs .Siriphut Jitjamnong) and the only child (Chawit Jitjamnong) on board One-Two-Go Orient-Thai Airlines flight OG269 Phuket Airport...

Words: 659 - Pages: 3

Premium Essay

Abhi

...social networking sites should be permanently banned, i am with this topic? I'll suggest a couple of possible reasons for arguing that social networking websites should be banned: Social networking sites bring privacy into the public doman. There are things abouteach of us that are best kept private and for good reason. We would generally reveal ourselves in the ways that we choose to those that we choose, except when it comes to the online world. It has been said that you can almost build up an entire profile of someone by their online habits. People are often naive about the dangers of identity theft, they stick to the same username from one site to the next, they post little snippets of information in various places without realising that each is like a piece of a jigsaw. If you find one common thread, such as a username, then it is relatively simple to find several pieces of one jigsaw, put them together, and you start to establish a comprehensive profile of that person. You might find out what they do for a living, the area in which they live, the names of their loved ones, their pets, their email address, their likes and dislikes, the list is endless. More and more people are becoming the victims of identity theft, if not for financial gain then for malicious purposes. Celebrities have had people pretend to be them on websites such as Twitter and Facebook, causing them a great deal of embarrassment. Everyday folk have been slandered, cyber bullied and impersonated...

Words: 668 - Pages: 3

Free Essay

Abhi

...Insect-Resistant GM Rice in Farmers' Fields: Assessing Productivity and Health Effects in China Jikun Huang, et al. Science 308, 688 (2005); DOI: 10.1126/science.1108972 The following resources related to this article are available online at www.sciencemag.org (this information is current as of January 8, 2009 ): Updated information and services, including high-resolution figures, can be found in the online version of this article at: http://www.sciencemag.org/cgi/content/full/308/5722/688 Downloaded from www.sciencemag.org on January 8, 2009 Supporting Online Material can be found at: http://www.sciencemag.org/cgi/content/full/308/5722/688/DC1 A list of selected additional articles on the Science Web sites related to this article can be found at: http://www.sciencemag.org/cgi/content/full/308/5722/688#related-content This article cites 5 articles, 1 of which can be accessed for free: http://www.sciencemag.org/cgi/content/full/308/5722/688#otherarticles This article has been cited by 47 article(s) on the ISI Web of Science. This article has been cited by 9 articles hosted by HighWire Press; see: http://www.sciencemag.org/cgi/content/full/308/5722/688#otherarticles This article appears in the following subject collections: Botany http://www.sciencemag.org/cgi/collection/botany Information about obtaining reprints of this article or about obtaining permission to reproduce this article in whole or in part can be found at: http://www.sciencemag.org/about/permissions.dtl Science...

Words: 4434 - Pages: 18

Free Essay

Abhi

...A Beautiful Place     I think we all have a beautiful place in our mind. I have a wonderful place that made me happy a lot of times, many years ago. But sometimes I think that I am the only person who likes this place and I'm asking myself if this place will be as beautiful as I thought when I will go back to visit it again. Perhaps I made it beautiful in my mind.     This place is meaningful to me because it is part of the county I loved, is part of the county where I grew up and is part of my childhood. This place is in the country in an old region named Appalachia, a small piece of the Appalachian Mountains, in a town named Pikeville.     Pikeville is a polluted town because of the coal industry. People live in apartment or condominium buildings because of its little space available. I grew up in one of the many buildings in Pikeville admiring from my bedroom window the beauty of the mountains, always exploring with my eyes the forest or the meadows, looking for a clean and quiet place. And, I found one on a hill in the back of the town. It is about 100 feet square, it has seven old trees, wild flowers and a lot of bugs and ants during summer time.     I used to go there to sit down on a rock and watch the town and my trees. There was a very old tree, a maple tree, with a huge trunk. The others were smaller, three in the back, three on my left side and the old maple tree on my right. There were flowers, many kinds, white, yellow, purple and blue. It...

Words: 704 - Pages: 3

Free Essay

Joins in Sql

...SQL. * Inner * Outer * Left * Right Cross JOIN or Cartesian Product This type of JOIN returns the cartesian product of rows from the tables in Join. It will return a table which consists of records which combines each row from the first table with each row of the second table. Cross JOIN Syntax is, SELECT column-name-list from table-name1 CROSS JOIN table-name2; Example of Cross JOIN The class table, ID | NAME | 1 | abhi | 2 | adam | 4 | alex | The class_info table, ID | Address | 1 | DELHI | 2 | MUMBAI | 3 | CHENNAI | Cross JOIN query will be, SELECT * from class, cross JOIN class_info; The result table will look like, ID | NAME | ID | Address | 1 | abhi | 1 | DELHI | 2 | adam | 1 | DELHI | 4 | alex | 1 | DELHI | 1 | abhi | 2 | MUMBAI | 2 | adam | 2 | MUMBAI | 4 | alex | 2 | MUMBAI | 1 | abhi | 3 | CHENNAI | 2 | adam | 3 | CHENNAI | 4 | alex | 3 | CHENNAI | INNER Join or EQUI Join This is a simple JOIN in which the result is based on matched data as per the equality condition specified in the query. Inner Join Syntax is, SELECT column-name-list from table-name1 INNER JOIN table-name2 WHERE...

Words: 1005 - Pages: 5

Free Essay

Heoroo

...ROMANTIC STORY (TITLE NOT DECIDED) SCENE 1 Golibaari firing ka awaaz, bloods gir rahe hain…. Kuch log gun liye hue, camera focus on them. Shoot kiye who log, background mein chilane ki awaz…. Entry of hero (RAJA Bhai), music background, kuch samay ki khamoshi…. Door se awaz aata hai bachao, Help Me!! Firing suru… n gundo ko maarke Raja Bhai uss ladki ko bachate hain… Dialogue By Narrator Raja Bhai, asli naam Raj Kishore Nanda, ek honhar aur imaandar ladka jiski khoobi apnea as pas ke galiyon mein masoor tha. Class mein 1st aane wala ladka kabhi bhi koi galat kaam nahi karta tha aur sabko izzat deta tha…. Doston ke saath masti bhi karta tha… Lekin padhai bhi… Bahut kuch sapne paal rakhe the, apne ghar walon ke liye, apne watan ke liye….. Lekin aisa kya hua jo usse underworld ke duniya ki ek jhunjhuna ne waala naam Raja Bhai bana diya aiya dekhte hain…….. SCENE 2 (discussion of friends, so called KHATTI) AAKASH : Sabko bola tha time se pahuchne ke liye (ghadi dekhte hue), koi aaya nahin, kahan gaye sab pata nahin SANTOSH: Are Aakash koi aaya nahin?? AAKASH: Pata nahin yaar, ye Raj, Rissi, Bhanu, Susant aur Shreyas kahan hain?? Tujhe call kiye the kya?? SANTOSH: Nahin yaar…. Arey who dekh… Saare aa rahe hain (All of thm comes in bike) BHANU: Sorry yaar late ho gaya AAKASH: Are mein ne kaha tha tym se pahuchne…. Humare pas tyme nahin hai aur….. SHREYAS: Are hum kya karein, yeh Raj Ke liye deri ho gayi…. SUSANT: Han yaar kab se hum uske ghar ke bahar khade the, who aa hi...

Words: 3050 - Pages: 13

Free Essay

Story

...Scene 1: Yogesh's Office (Yogesh is sitting at his desk. His desk is cluttered with files, papers, his tablet and laptop. There is a photo frame of VENKY sir on his table which is sitting precariously on his desk.) (Yogesh is doing something on his laptop. He is looking really worried) Narrator: Meet Mr. Yogesh Chandra, a pass-out from WE school. Like all Welingkarites, Yogesh is high on his core values of breakthrough thinking ,breakthrough execution,result-driven work ethic, innovation,blah-blah…..He is very superstitious and wears amulets and rings for improving his self-assumed wretched life. Boletoh..apna hero bilkul 3idiots ka Sharman Joshi…. Yogesh: (to himself) Yaar, ye sab hisab to saala tally hi nahi ho raha. Mere ad budget ki toh ekdam mother-sister ho gayi hai. Upar se saala peechle budget meeting me maine jo gas baata….jo gas baata…..uska ROI ab boss chun-chun dega. (Pointing to his left) Baitha hoga kamina 500 degree tak saliye garam karke. Yahape to saap bhi nahi mara aur lathi bhi toot gayi. Meri halat to ekdum andhe businessman jaisi ho gayi hai. Aankh lagi andhe ki, maaaa….. (Phone rings) (Yogesh looks at the audience and picks up the phone gingerly) Harshal: Mr. Chandra, come to my cabin RIGHT NOW! Yogesh: But sir, I'm…. Harshal: I said RIGHT NOW! Yogesh: (Gestures to the audience(thuk gayi)) *Black out* Scene 2: Harshal's office: BOSS Harshal is staring out of the window out of his corner office. Yogesh enters the scene. Yogesh: Sir,...

Words: 1944 - Pages: 8

Premium Essay

Khalid

...Mera naam Khalid Alnufaie hey. Main Saudi Arabia mein janam liya tha. Mere sheher ka naam jahan maine janam liya uska naam Taif hai. Main abhi 26 saal ka hun. Mere 3 bhai hain aur 1 bhen hey. Main apne sare bhai bhen main sabse bada hun. Maine high school ki padhai Saudi Arabia se 2002 mein kahtam ki. Fir mein Saudi Arabia mein college ki padhai ki 7 saal tak. Fir mein 2010 USA agaya aur padhai karne ke liye aur abhi main eek saal ki padhai khatam karli hai. Mujhe safar karna bhot pasand hey. Mein bhot sare desh ghum chukka hun jaise ki England, Egypt, Italy aur France. Inme mujhe sabse zada England mein maza aya. England bhot sundar desh hai lekin Englad thoda mhenga desh hai.Mujhe safar karne main bhot maza ata hai kyonki mujhe kafi aram milta hai. Main USA isiliye aya kyonki mujhe ghumna kafi pasand hai aur main naye log aur yahanki riti riwaz ko janna chahata hun. My name is Khalid Alnufaie. I was born in Saudi Arabia. The name of the city where I was born is Taif. I am 26 years old right now. I have 3 brothers and 1 sister. Among them I am the eldest one. I finished my high school in Saudi Arabia in the year 2002 and then I continued studying for the college for another 7 years. I came to USA in the year 2010 for further studies and so far I have finished 1 year of studying. I love travelling a lot. I have been to several countries like England, Egypt, Italy and France. Among these, I really loved England because it was very beautiful but a little expensive. The reason...

Words: 325 - Pages: 2

Free Essay

Knowledge

...What is the difference between public and private finance? Government expenditures are the expenditures incurred by the Government for development of the country and also on non-development objectives in view. Government revenue comes from taxation i.e. direct taxation and indirect taxation. Government ‘debt is obtained from internal and external sources. Loans from internal sources are obtained by selling Government securities to the people whereas external sources are those such as the World Bank, IMF etc. Public finance is for the benefit of the people in general unlike private financing which is confined to a particular purpose i.e. family matter only. We shall now take up the difference between the two. The basic difference between public and private financing is that an individual adjusts his expenditure in accordance with the given income. On the other hand, the Government relatively speaking adjusts its income in accordance with its expenditure. Thus, the individual is only able to spend so much but the government may spend as much as it likes and then care of the income. Relatively speaking the Government prepares its expenditure first or rather it estimates expenditure, and only then devises ways and means to obtain the amount required. However, sometimes the individual also does the same thing as the Government and vice versa. i.e. when the Government realizes a surplus budget it would increase expenditure in specific areas and when the public revenue is declining...

Words: 1107 - Pages: 5

Premium Essay

Fsdfdsf

...companies as far as brand promotion is concerned. The primary objective of advertisements is not to sell the product/service but to make the potential customer base aware of its existence and its uniqueness. But with changing times it becomes necessary for the companies to modify their approaches they use in their advertisements to reach out to the masses. Thousands of campaigns go live every year but only few stay in our mind. Ever wondered what made those ads stay in our minds forever and how companies change their marketing campaigns over years and more over why they do so? Your task is to do a comparative analysis between the ads (any one of the following pairs) and make a presentation of max 5 slides (excluding the cover slide). 1. ‘Oh Yes Abhi’ Pepsi (https://www.youtube.com/watch?v=Tq7VBfNN0vY) V/s ‘Yeh dil maange more’ Pepsi (https://www.youtube.com/watch?v=Y_kBbImdA98) Presents 2. ‘Mehendi’ Cadbury (https://www.youtube.com/watch?v=0KIqDAijbS8) V/s ‘Mithaas jo banae dosti ko...

Words: 551 - Pages: 3

Premium Essay

Saffola Ad Campaigns

...a person with poor health or worse. * Saffola Gold: Oil Kam, Pachhtava Kam Campaign acknowledges the rising awareness among people with respect to physiological health concerns and steers attention towards the latest Saffola Gold that has been formulated using superior Losorb technology, allowing it to be absorbed less in the food and hence protecting the health of the people. * Saffola Gold: Healthy Khao, Healthy Khao Campaign roped in celebrity chef Sanjeev Kapoor to promote Saffola Gold. The concept here being that the audience would have a face to associate with the product, specifically the face of a well know chef and trusted TV personality. He propagated the need for people to eat healthier. * Saffola Gold: Abhi Toh Yeh Jawaan Hai Campaign was targeted at adults, in particular those with stressful jobs taking a toll on their health. The concept being that Saffola Gold is a healthy oil and also helps in lowering cholesterol. * Saffola Tasty: Aaj Ke Zamaane Mein Dil Ki Hifazat Campaign covered the unique selling point of the product...

Words: 376 - Pages: 2

Premium Essay

My Summer

...The Reoccurring Theme Of Death Abhi Jain 4th hour Extremely Loud and Incredibly Close, written by Jonathan Foer, portrays the struggles of a blossoming boy dealing with his father’s death, a victim of the cataclysmal attacks on September 11th, 2001. To readers this may seem like a novel about the September 11th attacks. However Foer does a meritorious job with the novel, depicting the emotion and confusion going on in nine-year-old Oskar Schell head. Extremely Loud & Incredibly Close is a wonderful example of a novel that deals with the many facets of life after a tragic event. Death is a major reoccurring them in the novel, perceptible not only in Oskar’s loss of his father, but also in his grandparents’ loss of Anna. To anyone, loosing a loved one is a tragic event in someone’s life. Imagine what nine-year-old Oskar is going through when loosing his father, role model, and best friend for no reason. Oskar dynamic emotional changes began to affect the love ones around him. Oskar becomes more violent at home by throwing tantrums, yelling at his mother, and frequently giving he bruises. To cope with his loss, Oskar keeps his mind constantly “inventing,” and embarks on a hunt to find the mystery lock to which his father’s key belongs. When Oskar finally found the lock, he is confused and distraught that there is no longer a way to connect with his father, “But I still couldn't figure out what it all meant. The more I found out, the less I understood.” This quote shows...

Words: 430 - Pages: 2

Premium Essay

Asheville

...in the Mountain Xpress published this past August, Heather Dilashaw, the program director for the Homeless Initiative Coalition in Asheville stated, “It does seem to be tied to continued depressed economic opportunity, with rents in the Asheville area [continuing] to be above fair-market value [and] difficult to attain. “Ten years ago, a younger adult who didn't have other family support or resources could get a job, even if it was a fairly low-wage job, and still figure out how to make housing work. That's becoming more and more difficult to do,” (Forbes, 2013). There are many reasons one could fall victim to homelessness; job loss, addiction, and/or mental illness, among others. According to the Asheville-Buncombe Homeless Initiative (ABHI), the population of homelessness has seen a steady increase, with the 18- to...

Words: 1714 - Pages: 7

Premium Essay

Effective Business Communication Through Theatre Technique

...MANAGEMENT DEVELOPMENT INSTITUTE, GURGAON Effective Business Communication through Theatre Technique Core Faculty: Ashok Kapoor Course Outline Introduction Theatre is not merely a metaphor for workplace: it already exists in daily life, and workplace is just its extension. Individually and collectively, within and without, people are in a dynamic and dramatic relationship that is now planned or rehearsed and now improvised. The Corporate is engaged in an ongoing drama that is being played on the larger stage of society. In their book, ‘Dramatic Success’, (Nicholas Brealey Publishing, 2004), authors Andrew Leigh and Michael Maynard reiterate that Corporate is Theatre. They have looked at ‘Self’, ‘Team’ and ‘Organisation’ as the three acts of a play. The dramatic scenario in Self consists of ‘Connection’, ‘Talent’ and ‘Power’; in Team of ‘Alignment’, ‘Creativity’ and ‘Exploration’; and in Organisation as ‘Insight’, ‘Inspiration’ and ‘Initiative’. The key to being an effective player in corporate processes is to learn to observe, sense and listen to the unfolding drama at workplace. Theatre techniques prepare you to see yourself objectively in a dynamic situation, and thereby help you to realise responsibility and strategise communication. They aim to help the student transform and become an inspired performer, an effective team player and a leader. The theoretical model of the Communication Process – comprising ‘coding’, ‘decoding’, ‘feedback’, etc.- is...

Words: 988 - Pages: 4

Premium Essay

Mr. Na

...Green Computing Research Project – Part 1 CIS 517 – IT Project Management Green Computing Research Project Computer science educators are uniquely positioned to promote greater awareness of Green Computing, using the academic setting to encourage environmentally conscious use of technology. This paper reports on practical techniques that can engage faculty and students, enabling Green Computing to be integrated into the classroom and research laboratory. Analysis and empirical evaluation of each reported technique is given, comparing the efficacy of each in terms of energy, environmental and financial cost savings. These results are provided as technological and economic evidence for the benefits of “Going Green,” and to promote education in Green Computing in the classroom, department and research lab (Shen, W, 2005). We Are Big, Inc. is an international firm with over 100,000 employees in different countries. The goal of the project is to find environment friendly energy resources to reduce cost and increase energy efficiency. Green Computing Research Project has been authorized on January 24, 2013 as the date of authorization. Project Name: Green Computing Research Project Date of Authorization: January 24, 2013 Project Manager: Hatem Numan 1-320-761-8787 Hatem@wearebig.com Project Start date: January 24, 2013 Project End: July 24, 2013 Project budget: $500,000 Project Objectives: The objectiveof the project is to preparea detailed...

Words: 714 - Pages: 3