Problem Set 5:
1) Advantages include the fact that polyclonal is cheaper, a mixture of different antibodies are made while monoclonal is only one specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later.
3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect.
4) Sense: 5’ aagccccatcgcctggcattg 3’
Linker Loop: 5’ uucaagaga 3’
Antisense: 5’ caatgccaggcgatggggctt 3’
Poly U: UUUUU
The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell.
The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high.
5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold increase.
Fold increase in the internal Actin control = 1058/479= 2.21 fold increase.
Real fold increase of HDAC3 = 9.85/2.21= 4.46.
6)
The threshold cycles are:
1L1-b con: 29, copy number = (-39.204 + 29)/-3.488= 2.93
1L1-b vit: 18, copy number = (-39.204 + 18)/-3.488= 6.08
RPLPO vit: 20, copy number = (-39.204 + 20)/-3.488= 5.51
RPLPO con: 20, copy number = (-39.204 + 20)/-3.488= 5.51